IDT Analyze Oligo

Overview

Analyze an oligonucleotide using the IDT OligoAnalyzer API. Calculates melting temperature (Tm), GC content, molecular weight, molar extinction coefficient, and nmol/OD260 and ug/OD260 yields. Tm is calculated using nearest-neighbor thermodynamic parameters (SantaLucia 1998) under user-specified salt conditions (Na+, Mg2+, dNTPs). Supports DNA and RNA oligos up to 200 bases. Use this BEFORE ordering primers/probes to verify Tm, check GC balance, and estimate synthesis yields. Complements NEB_Tm_calculate (which provides polymerase-specific Tm with salt corrections) and DNA_calculate_gc_content (local, no Tm). For self-dimer/homodimer assessment, use IDT_check_self_dimer.

Status

The most recent probe succeeded. Safe to call from the agent today.

Last probed

1d ago

Last success

1d ago

Last latency

101ms

Schema

JSON Schema the agent (or your API call) must match.

{
  "properties": {
    "dntps_concentration_mm": {
      "description": "dNTPs concentration in millimolar (mM). dNTPs chelate Mg2+, reducing effective Mg2+. Typical range: 0-10 mM. Default: 0 mM. Standard PCR uses 0.2-0.8 mM.",
      "type": [
        "number",
        "null"
      ]
    },
    "mg_concentration_mm": {
      "description": "Magnesium (Mg2+) concentration in millimolar (mM). Stabilizes duplexes, raising Tm. Typical range: 0-20 mM. Default: 0 mM. Standard PCR uses 1.5-3.0 mM.",
      "type": [
        "number",
        "null"
      ]
    },
    "na_concentration_mm": {
      "description": "Sodium (Na+) concentration in millimolar (mM). Affects Tm calculation. Typical range: 0-1000 mM. Default: 50 mM. Standard PCR buffer is ~50 mM.",
      "type": [
        "number",
        "null"
      ]
    },
    "oligo_concentration_um": {
      "description": "Oligo concentration in micromolar (uM). Affects Tm slightly. Default: 0.25 uM.",
      "type": [
        "number",
        "null"
      ]
    },
    "oligo_type": {
      "description": "Type of oligonucleotide: 'DNA' or 'RNA'. Default: 'DNA'.",
      "type": [
        "string",
        "null"
      ]
    },
    "sequence": {
      "description": "Oligonucleotide sequence (5' to 3'). Must contain only A, T, C, G (DNA) or A, U, C, G (RNA) bases. Length: 5-200 bases. Example: 'AGCGGATAACAATTTCACACAGGA'",
      "type": "string"
    }
  },
  "required": [
    "sequence"
  ],
  "type": "object"
}

Examples (1)

{
  "sequence": ""
}

Identifiers

Catalog ID

tu_IDT_analyze_oligo

Tool name

IDT_analyze_oligo

Added

2026-05-01 00:58Z

Tags

tooluniverse