IDT Check Self Dimer
Check an oligonucleotide for self-complementarity and homodimer (self-dimer) formation using the IDT OligoAnalyzer API. Returns predicted self-dimer structures with their thermodynamic stability (delta-G in kcal/mol), number of base pairs, and alignment diagrams. A more negative delta-G indicates a more stable (problematic) dimer. Risk assessment: delta-G > -3.0 kcal/mol is low risk, -3.0 to -6.0 is moderate risk, < -6.0 is high risk. Use this tool AFTER designing primers (DNA_primer_design or…
Overview
Check an oligonucleotide for self-complementarity and homodimer (self-dimer) formation using the IDT OligoAnalyzer API. Returns predicted self-dimer structures with their thermodynamic stability (delta-G in kcal/mol), number of base pairs, and alignment diagrams. A more negative delta-G indicates a more stable (problematic) dimer. Risk assessment: delta-G > -3.0 kcal/mol is low risk, -3.0 to -6.0 is moderate risk, < -6.0 is high risk. Use this tool AFTER designing primers (DNA_primer_design or manual) and BEFORE ordering, to verify primers won't form stable homodimers that reduce PCR efficiency. For basic oligo properties (Tm, GC%, MW), use IDT_analyze_oligo instead.
Status
The most recent probe succeeded. Safe to call from the agent today.
- Last probed
- 1d ago
- Last success
- 1d ago
- Last latency
- 84ms
Schema
JSON Schema the agent (or your API call) must match.
{
"properties": {
"mg_concentration_mm": {
"description": "Magnesium (Mg2+) concentration in millimolar (mM). Default: 0 mM.",
"type": [
"number",
"null"
]
},
"na_concentration_mm": {
"description": "Sodium (Na+) concentration in millimolar (mM). Affects dimer stability. Default: 50 mM.",
"type": [
"number",
"null"
]
},
"sequence": {
"description": "Oligonucleotide sequence (5' to 3'). Must contain only A, T, C, G, U bases. Length: 5-200 bases. Example: 'AGCGGATAACAATTTCACACAGGA'",
"type": "string"
},
"temperature_celsius": {
"description": "Temperature in Celsius for dimer stability calculation. Use your expected annealing temperature. Default: 25.",
"type": [
"number",
"null"
]
}
},
"required": [
"sequence"
],
"type": "object"
}Examples (1)
Default IDT Check Self Dimer call
{
"sequence": ""
}Anonymous-safe example. Rate-limited; no sign-in required.
Identifiers
- Catalog ID
- tu_IDT_check_self_dimer
- Tool name
- IDT_check_self_dimer
- Added
- 2026-05-01 00:58Z
- Tags
- tooluniverse