NEB Tm Calculate

Overview

Calculate primer melting temperature (Tm) and annealing temperature (Ta) using the NEB Tm Calculator API. Uses thermodynamic nearest-neighbor calculations (SantaLucia 1998) with polymerase-specific salt corrections for accurate PCR temperature predictions. Supports all NEB DNA polymerases including Q5, Phusion, Taq, OneTaq, and custom buffer conditions. When two primers are provided, also calculates the recommended annealing temperature (Ta). Complements the local DNA_primer_design tool by providing manufacturer-validated Tm values. Common polymerase codes: 'q5-0' (Q5 High-Fidelity), 'phusion-0' (Phusion HF Buffer), 'taq-0' (Taq Standard Buffer), 'onetaq-0' (OneTaq Standard Buffer). Use NEB_Tm_list_polymerases to see all available product codes.

Status

The most recent probe succeeded. Safe to call from the agent today.

Last probed

1d ago

Last success

1d ago

Last latency

101ms

Schema

JSON Schema the agent (or your API call) must match.

{
  "properties": {
    "monovalent_salt_mm": {
      "description": "Monovalent salt concentration in mM. Only used when polymerase is 'custom'. Typical range: 20-100 mM. Default: 50.",
      "type": [
        "integer",
        "null"
      ]
    },
    "polymerase": {
      "description": "NEB polymerase product code. Determines buffer composition for Tm calculation. Common codes: 'q5-0' (Q5 HF, default), 'phusion-0' (Phusion HF Buffer), 'taq-0' (Taq Standard Buffer), 'onetaq-0' (OneTaq Standard Buffer), 'custom' (specify monovalent_salt_mm). Use NEB_Tm_list_polymerases for full list. Default: 'q5-0'.",
      "type": [
        "string",
        "null"
      ]
    },
    "primer_concentration": {
      "description": "Primer concentration in nanomolar (nM). Affects Tm calculation. Common values: 200-500 nM. Default: 250.",
      "type": [
        "integer",
        "null"
      ]
    },
    "primer_sequence": {
      "description": "Forward primer DNA sequence (5' to 3'). Must contain only A, T, C, G bases and be at least 10 nt long. Example: 'AGCGGATAACAATTTCACACAGGA'",
      "type": "string"
    },
    "primer_sequence_2": {
      "description": "Optional reverse primer DNA sequence (5' to 3'). When provided, the API also calculates annealing temperature (Ta). Example: 'CCTCACTAAAGGGAACAAAAGCTG'",
      "type": [
        "string",
        "null"
      ]
    }
  },
  "required": [
    "primer_sequence"
  ],
  "type": "object"
}

Examples (1)

{
  "primer_sequence": ""
}

Identifiers

Catalog ID

tu_NEB_Tm_calculate

Tool name

NEB_Tm_calculate

Added

2026-05-01 00:58Z

Tags

tooluniverse